Big Data, Genes, and Medicine Coursera Quiz Answers 2022 | All Weeks Assessment Answers [💯Correct Answer]

by
Big Data, Genes, and Medicine Coursera Quiz Answers 2022 | All Weeks Assessment Answers [💯Correct Answer]
Table of Contents

Hello Peers, Today we are going to share all week’s assessment and quizzes answers of the Big Data, Genes, and Medicine course launched by Coursera totally free of cost✅✅✅. This is a certification course for every interested student.

In case you didn’t find this course for free, then you can apply for financial ads to get this course for totally free.

Check out this article – “How to Apply for Financial Ads?”

About The Coursera

Coursera, India’s biggest learning platform launched millions of free courses for students daily. These courses are from various recognized universities, where industry experts and professors teach in a very well manner and in a more understandable way.

Here, you will find Big Data, Genes, and Medicine Exam Answers in Bold Color which are given below.

These answers are updated recently and are 100% correct✅ answers of all week, assessment, and final exam answers of Big Data, Genes, and Medicine from Coursera Free Certification Course.

Use “Ctrl+F” To Find Any Questions Answer. & For Mobile User, You Just Need To Click On Three dots In Your Browser & You Will Get A “Find” Option There. Use These Option to Get Any Random Questions Answer.

About Big Data, Genes, and Medicine Course

This course distills for you the expert knowledge and abilities attained by experts in Bioinformatics and Health Big Data Science. The biology, chemistry, genetics, and medical aspects of the human body will be integrated with the science of big data, and you’ll learn how to use the wealth of data that is at your disposal and that we are only now beginning to make sense of. We’ll look into the various steps needed to master big data analytics on actual datasets, such as Next Generation Sequencing data, in the context of healthcare and biology, from getting the data ready for analysis to finishing the analysis to deriving conclusions, visualizing them, and sharing the conclusions.

You will obviously be well-positioned to apply for or advance to careers in biomedical data analytics and bioinformatics once you have mastered these in-demand abilities. Regardless of your technical or biomedical skill levels, you will learn extremely valuable new or honed skills that will set you apart as a professional and inspire you to go even further into biomedical Big Data. I hope this course will pique your curiosity about the huge opportunities provided by readily accessible Big Data to better comprehend, prevent, and treat diseases.

SKILLS YOU WILL GAIN

  • Bioinformatics
  • Data Clustering Algorithms
  • Big Data
  • R Programming

Course Apply Link – Big Data, Genes, and Medicine

Big Data, Genes, and Medicine Quiz Answers

Week 01

DNA, RNA, Genes, and Proteins

Q1. The sequence “GTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGC” can be a fragment of (check only one):

  • Protein
  • RNA
  • DNA

Q2. Compare and contrast the different types of RNA in a cell by finding the one FALSE answer among the following:

  • rRNA, or ribosomal RNA, is located in the ribosomes and an integral part of them (60%).
  • tRNA, or transfer RNA, assists in the mRNA translation, by carrying each new amino acid to the growing end of a protein being created.
  • Each aminoacid has its specific ribosomal rRNA in a ribosome.
  • mRNA, or messenger RNA, is the one which specializes in coding for proteins.

Transcription and Translation Processes

Q1. What is the RNA sequence complementary to the DNA sequence “AGAATCGGGACA”

  • “TCTTAGCCCTGT”
  • “AGAATCGGGACA”
  • “UCUUAGCCCUGU”
  • “AGAAUCGGGACA”

Q2. Which of the following codons have a different amino acid associated with them (you may use the protein wheel to do the translation)?

  • AUU
  • AUG
  • AUA
  • AUC

Q3. Which of the following biological macromolecules will never contain a “Tyrosine” subunit? Choose all that apply.

  • RNA
  • DNA
  • Protein

Data, Variables, and Big Datasets

Q1. What kind of data is represented by the Gender (Male / Female) and Insurance (Medicare / Medicaid / Blue Cross / Commercial / Other) variables? Choose all that apply. (Hint: Focus on the nature of the data contained by the variable rather than the graphical display of that data). ngcb33

  • Categorical
  • Nominal
  • Numeric

Q2. What kind of data would most likely be represented by a Body Temperature (°C) variable? Choose all that apply.

  • Interval
  • Ratio
  • Nominal
  • Ordinal

Working with cBioPortal

Q1. To answer the following question, submit a query using a “User-defined List” as input at www.cbioportal.org, with the “tcga” cancer study tag entered:

Querying JAK2 on cBioPortal, what accounts for the majority of its alteration in GBM (TCGA 2008)? Hint: see the “Overview” tab.

  • Amplification
  • Deletion
  • Mutation

Q2. To answer the following question, submit a query using a “User-defined List” as input at www.cbioportal.org, with the “tcga” cancer study tag entered:

Querying EGFR ERBB2 ERBB3 ERBB4 on cBioPortal, which of the following mutation types does ERBB2 exhibit the most often? Hint: see the “Mutations” tab.

  • Truncating
  • Missense
  • In-frame

Q3. To answer the following question, submit a query using a “User-defined List” as input at www.cbioportal.org, with the Breast Invasive Carcinoma (TCGA, Cell 2015) dataset selected. Then, make sure to select “mRNA Expression data z-Scores (RNA Seq V2 RSEM)” with a z-score threshold of 2.0:

Querying JAK2 on cBioPortal, how is the JAK2 gene mRNA mostly dysregulated? Hint: see the “OncoPrint” tab.

  • Downregulated
  • Upregulated

Week 02

Datasets and Files

Q1. Which of the following is an example of a File?

  • An Excel spreadsheet
  • A cell in an Excel spreadsheet
  • A row in an Excel spreadsheet
  • A column in an Excel spreadsheet

Q2. A CSV file uses a special character to separate between fields. Which of the following are commonly used separator characters?

  • Character “a”
  • A tab
  • A space
  • A comma

Data Preprocessing Tasks

Q1. Data preprocessing tasks include (choose all that apply):

  • Discretizing variables
  • Replacing missing values
  • Normalizing data
  • Adding variables
  • Imputing missing values

Q2. Which of the following is a type of data reduction?

1 point

  • Data normalization
  • Feature selection
  • Data imputation
  • Data understanding

Normalization and Discretization

Q1. When normalizing the dataset [10, 20, 30, 40, 50] through Z-score normalization, which of the following elements would be normalized to 0?

  • 20
  • 10
  • 40
  • 50
  • 30

Q2. Consider the data [2, 4, 8, 16] discretized by equal-depth binning. Which of the following is a valid set of equal-depth bin intervals for these data?

  • [2, 3], [4, 16]
  • [2, 7], [8, 16]
  • [1, 5], [6, 10], [11, 15], [16, 20]
  • [2, 8], [9, 16]

Data Reduction

Q1. When sampling a dataset [10, 20, 30, 40, 50, 60, 70, 80, 90] with Simple Random Sampling With Replacement, which samples can we obtain? Choose all that apply.

  • [10]
  • [20, 40, 40]
  • [30, 30, 30, 30]
  • [10, 50, 60]

Q2. When sampling a dataset [10, 10, 20, 30] with Simple Random Sampling Without Replacement, which samples can we obtain? Choose all that apply.

  • [10, 20, 20]
  • [10, 20, 30]
  • [10, 10, 20]

Working with R

Q1. The code below loads a previously installed package into R.

library(examplePackage)

Which of the following is not a conventional way to install an R package?

  • From Bioconductor, or another contributed package resource
  • Directly from The Comprehensive R Archive Network install.packages()
  • Purchasing an annual proprietary license for CRAN

Q2. Which of the following statements about Anaconda is not true?

  • Anaconda can provide a Jupyter notebook written in Python to run scripts online.
  • Anaconda provides R by default.
  • Anaconda is a set of tools for data science.

Week 03

Feature Selection Methods

Q1. With a dataset having 4 features, how many different subsets of features are there

1 point

  • 16
  • 8
  • 4
  • 2

Q2. Which of the following are examples of feature selection methods? Choose all that apply.

  • Log transformation.
  • Filter methods.
  • Student’s t-test.
  • Wrapper methods.

Differentially Expressed Genes

Q1. Which of the following statements is FALSE regarding the identification of deferentially expressed genes?

  • Identifying differentially expressed genes requires more than one subject in each population examined.
  • Identifying differentially expressed genes requires one and only one population (e.g., diseased subjects).
  • Identifying differentially expressed genes requires the consideration of multiple expression levels across multiple subjects.

Q2. What do you think could cause a gene to express differentially when a person has a particular disease when compared with normal subjects?

Heatmaps

Q1. Which of the following best describes the axes of a heatmap?

  • One axis may show genes while the other axis may show gene expression.
  • One axis may show subjects while the other axis may show gene expression.
  • One axis shows genes while the other axis shows subjects.

Q2. Which of the following illustrates an example of a heatmap?

  • .
ngcb33
  • .
ngcb33
  • .Correct answer
ddm4h4gsEeaT1Q4Eo0QvOw 362dc4b1ae9c3e1f6b722dca5ed4fe80 bargraph

Week 04

Overview

Q1. At which stage of Big Data analytics are classification and prediction methods used?

  • Domain understanding
  • Data understanding
  • Data preparation
  • Model building
  • Training and evaluation
  • Deployment

Q2. When building a classifier, which of following steps are required at a minimum? Choose all that apply.

  • Training step
  • Test step

Classification with Analogy

Q1. Which of the following correctly describes a support vector machine (SVM) algorithm? Choose all that apply.

  • It uses a kernel function to solve non-linear problems as if they were linear.
  • It uses an ensemble of decision trees to separate classes.
  • It aims at finding an optimal hyperplane to separate objects into separate classes.

Classification based on Rules

Q1. Which of the following best describes a decision tree?

  • It requires the user to specify known class labels for the training step.
  • It uses the analogy of the brain organization to create a tree.
  • It builds a tree that is as compact as possible proceedings from bottom to top.

Classification with Neural Networks

Q1. Which of the following correctly describes a neural network?

  • An input layer, one or several hidden layers, and an output layer are required to solve complex problems.
  • It uses prior probabilities to calculate the classification rule.
  • It uses a kernel function to solve non-linear problems as if they were linear.

Classification based on Statistics

Q1. Which of the following are statistical methods for classification? Choose all that apply.

  • Generalized Linear Models (GLM)
  • Bayesian network
  • Logistic regression

Classification based on Probabilities

Q1. Which of the following are names for probabilistic models? Choose all that apply

  • Graphical models
  • Generalized Linear Models (GLM)
  • Bayesian networks
  • Decision trees

Prediction Models

Q1. Consider the scenario where a researcher uses neural networks to predict the presence or absence of cancer from measured variables. This is an example of which of the following models?

  • Classification
  • Prediction
  • Clustering

Week 05

Gene Alterations

Q1. Which of the following are main effects of gene alterations? Choose all that apply.

  • Underexpression of the corresponding gene
  • Replacement of a chromosome
  • Repression of a transcript
  • Overexpression of the corresponding gene
  • Creation of different forms of proteins

Q2. Which of the following terms best describes a genetic event in which the part of one chromosome combines with part of another chromosome?

  • Silent mutation
  • Translocation
  • Missense mutation
  • Nonsense mutation

Gene Mutations

Q1. Which terms describe the type of mutation shown in the following figure? Choose all that apply.

ngcb33
  • A single point mutation
  • A nonsense mutation
  • A truncating mutation
  • A synonymous mutation

Q2. Which of the following describes an individual homozygous for Gene A?

  • The individual has two different alleles for Gene A.
  • The individual has two copies of the same allele for Gene A.

Q3. To answer the following question, submit a query using a “User-defined List” as input at www.cbioportal.org, with the Uterine Corpus Endometrial Carcinoma (TCGA, Nature 2013) dataset selected. Then, make sure to select “Mutations” only:

Querying PTEN on cBioPortal, what percentage of diagnosed patients have genetic mutations for this gene? Hint: see the “OncoPrint” tab.

Copy Number Alterations

Q1. Which of the following events would most likely lead to over-expression of Gene A?

1 point

  • Repression of Gene A through DNA methylation.
  • A synonymous mutation in the coding portion of Gene A.
  • A decrease in the copy number of Gene A.
  • An increase in the copy number of Gene A.

Q2. Which of the following accurately describes the difference between gene amplification and gene copy number gain?

  • The number of copies of a gene in gene amplification is much smaller than in gene copy number gain.
  • The number of copies of a gene in gene amplification is much larger than in gene copy number gain.

Genomic Alterations and Gene Expressions

Q1. To answer the following question, submit a query using a “User-defined List” as input at www.cbioportal.org, with the Uterine Corpus Endometrial Carcinoma (TCGA, Nature 2013) dataset selected. Then, make sure to select “mRNA Expression data z-Scores (RNA Seq V2 RSEM)” with a z-score threshold of 2.0:

Querying EGFR on cBioPortal, what percentage of diagnosed patients have genetic mutations, copy number variations, or gene expression alterations for this gene? Hint: see the “OncoPrint” tab.

Q2. To answer the following question, submit a query using a “User-defined List” as input at www.cbioportal.org, with the Uterine Corpus Endometrial Carcinoma (TCGA, Nature 2013) dataset selected. Then, make sure to select “mRNA Expression data z-Scores (RNA Seq V2 RSEM)” with a z-score threshold of 2.0:

Querying EGFR on cBioPortal, which of the following is true about this gene? Hint: see the “OncoPrint” tab.

  • Most gene alterations are truncating mutation events.
  • Most gene alterations are mRNA upregulation events.
  • Most gene alterations are amplification events.
  • Most gene alterations are missense mutation events.

Week 06

Clustering

Q1. Which of the following best describes a cluster?

  • A type of supervised learning method.
  • A group of users of data analytics services.
  • A group of data within a dataset.

Q2. Which of the following are criteria used for assessing the performance of a clustering method? Choose all that apply.

  • Robustness to noise
  • Understandability
  • Scalability

Q3. What is the Euclidean distance between the two points (1, 3) and (1, 4) in a dataset?

Clustering Methods

Q1. Which of the following statements correctly apply to KMeans clustering? Choose all that apply.

  • The centroid of a cluster is calculated as the average of the samples in that cluster.
  • KMeans clustering is robust to outliers.
  • KMeans automatically determines the optimal number of clusters in a dataset.

Q2. Which of the following statements correctly apply to density-based clustering? Choose all that apply.

  • Clusters can have any shape.
  • It is a computationally expensive clustering algorithm.
  • The centroid of a cluster is calculated as the median of the samples in that cluster.

Q3. Hierarchical clustering that starts from the whole dataset and progressively creates clusters of smaller and smaller size is called:

  • Divisive
  • Agglomerative

Pathways

Q1. A cis-regulatory circuit involves:

  • Upstream regulation factors not located close to the gene being regulated.
  • Only transcription factors located close to the gene being regulated.

Q2. Which of the following are databases through which known pathways can be found? Choose all that apply.

  • BIOCARTA
  • REACTOME
  • DBSCAN

Conclusion

Hopefully, this article will be useful for you to find all the Week, final assessment, and Peer Graded Assessment Answers of Big Data, Genes, and Medicine Quiz of Coursera and grab some premium knowledge with less effort. If this article really helped you in any way then make sure to share it with your friends on social media and let them also know about this amazing training. You can also check out our other course Answers. So, be with us guys we will share a lot more free courses and their exam/quiz solutions also, and follow our Techno-RJ Blog for more updates.

118 thoughts on “Big Data, Genes, and Medicine Coursera Quiz Answers 2022 | All Weeks Assessment Answers [💯Correct Answer]”

  1. Its superb as your other articles : D, appreciate it for putting up. “Always be nice to people on the way up because you’ll meet the same people on the way down.” by Wilson Mizner.

    Reply

  2. I’ve been surfing on-line greater than 3 hours today, yet I by no means found any interesting article like yours. It’s lovely price sufficient for me. Personally, if all website owners and bloggers made just right content as you did, the web might be much more helpful than ever before.

    Reply

  4. Hi there, just become alert to your blog via Google, and located that it’s truly informative. I’m going to watch out for brussels. I will be grateful if you happen to continue this in future. A lot of other people will likely be benefited from your writing. Cheers!

    Reply

  6. I think this website has got some rattling good information for everyone. “It is easy enough to define what the Commonwealth is not. Indeed this is quite a popular pastime.” by Elizabeth II.

    Reply

  8. Along with every thing which seems to be building inside this subject matter, a significant percentage of perspectives are rather refreshing. Even so, I beg your pardon, because I can not subscribe to your entire suggestion, all be it refreshing none the less. It seems to me that your opinions are generally not completely validated and in reality you are your self not totally convinced of the argument. In any case I did enjoy looking at it.

    Reply

  9. Thank you for the sensible critique. Me and my neighbor were just preparing to do some research about this. We got a grab a book from our area library but I think I learned more from this post. I’m very glad to see such fantastic information being shared freely out there.

    Reply

  12. hi!,I really like your writing very a lot! proportion we communicate extra approximately your article on AOL? I require an expert in this house to solve my problem. Maybe that’s you! Having a look forward to see you.

    Reply

  13. Thanks a lot for giving everyone an exceptionally marvellous possiblity to discover important secrets from this blog. It can be so fantastic plus stuffed with a good time for me and my office co-workers to visit your website no less than 3 times every week to study the newest guides you will have. And lastly, I’m also actually motivated with your astounding pointers served by you. Some 2 areas on this page are in reality the very best we’ve ever had.

    Reply

  14. I just could not depart your web site prior to suggesting that I really enjoyed the standard info a person provide for your visitors? Is gonna be back often to check up on new posts

    Reply

  15. I am curious to find out what blog platform you happen to be utilizing? I’m experiencing some minor security problems with my latest site and I’d like to find something more risk-free. Do you have any suggestions?

    Reply

  16. I feel that is one of the so much vital info for me. And i am satisfied studying your article. However want to commentary on few common things, The site taste is ideal, the articles is truly nice : D. Good process, cheers

    Reply

  17. Its such as you read my mind! You seem to understand a lot about this, like you wrote the e book in it or something. I believe that you simply could do with some p.c. to power the message home a bit, however other than that, that is magnificent blog. A fantastic read. I will definitely be back.

    Reply

  33. Excellent post but I was wanting to know if you could write a litte more on this topic? I’d be very thankful if you could elaborate a little bit further. Cheers!

    Reply

  38. I haven?¦t checked in here for a while as I thought it was getting boring, but the last several posts are good quality so I guess I will add you back to my everyday bloglist. You deserve it my friend 🙂

    Reply

  42. Hmm it seems like your blog ate my first comment (it was super long) so I guess I’ll just sum it up what I had written and say, I’m thoroughly enjoying your blog. I too am an aspiring blog blogger but I’m still new to the whole thing. Do you have any suggestions for first-time blog writers? I’d definitely appreciate it.

    Reply

  50. Fantastic goods from you, man. I’ve understand your stuff previous to and you are just too great. I actually like what you’ve acquired here, certainly like what you are stating and the way in which you say it. You make it entertaining and you still take care of to keep it wise. I can not wait to read far more from you. This is really a great website.

    Reply

  85. I am really enjoying the theme/design of your website. Do you ever run into any internet browser compatibility problems? A couple of my blog visitors have complained about my site not operating correctly in Explorer but looks great in Firefox. Do you have any advice to help fix this issue?

    Reply

  93. Hi would you mind stating which blog platform you’re using?

    I’m going to start my own blog soon but I’m having a hard time deciding between BlogEngine/Wordpress/B2evolution and Drupal.
    The reason I ask is because your layout seems different then most blogs and
    I’m looking for something completely unique.
    P.S Sorry for being off-topic but I had to ask!

    Reply

  94. To announce present rumour, adhere to these tips:

    Look for credible sources: http://tools4f.com/library/pgs/what-happened-to-katie-walls-on-spectrum-news.html. It’s eminent to guard that the report source you are reading is reputable and unbiased. Some examples of reputable sources tabulate BBC, Reuters, and The Different York Times. Read multiple sources to get a well-rounded aspect of a discriminating statement event. This can support you return a more ended facsimile and avoid bias. Be in the know of the angle the article is coming from, as even reputable news sources can be dressed bias. Fact-check the low-down with another origin if a scandal article seems too staggering or unbelievable. Many times pass unshakeable you are reading a fashionable article, as news can transmute quickly.

    Nearby following these tips, you can fit a more au fait dispatch reader and more intelligent be aware the cosmos around you.

    Reply

  101. Positively! Finding information portals in the UK can be unendurable, but there are numerous resources available to cure you find the best in unison for you. As I mentioned already, conducting an online search for http://scas.org.uk/wp-content/pages/martha-maccallum-age-how-old-is-martha-maccallum.html “UK news websites” or “British information portals” is a enormous starting point. Not only purposefulness this hand out you a comprehensive shopping list of news websites, but it choice also afford you with a better understanding of the coeval communication scene in the UK.
    In the good old days you secure a file of future account portals, it’s prominent to evaluate each one to influence which best suits your preferences. As an benchmark, BBC Advice is known for its intention reporting of intelligence stories, while The Keeper is known representing its in-depth criticism of political and social issues. The Disinterested is known representing its investigative journalism, while The Times is known in search its business and wealth coverage. During concession these differences, you can select the news portal that caters to your interests and provides you with the news you hope for to read.
    Additionally, it’s worth looking at local despatch portals with a view fixed regions within the UK. These portals produce coverage of events and good copy stories that are fitting to the area, which can be especially cooperative if you’re looking to hang on to up with events in your town community. For exemplar, municipal news portals in London classify the Evening Paradigm and the Londonist, while Manchester Evening Hearsay and Liverpool Reproduction are stylish in the North West.
    Inclusive, there are many tidings portals at one’s fingertips in the UK, and it’s important to do your digging to see the united that suits your needs. By means of evaluating the unconventional news broadcast portals based on their coverage, variety, and essay standpoint, you can decide the song that provides you with the most related and attractive info stories. Decorous destiny with your search, and I anticipation this bumf helps you discover the perfect dope portal suitable you!

    Reply

  113. Please let me know if you’re looking for a article writer for your blog.
    You have some really good posts and I feel I would be a good asset.
    If you ever want to take some of the load off, I’d love to write some articles for your blog in exchange for a link back
    to mine. Please shoot me an e-mail if interested. Kudos!

    Reply

Leave a Comment

Ads Blocker Image Powered by Code Help Pro

Ads Blocker Detected!!!

We have detected that you are using extensions to block ads. Please support us by disabling these ads blocker🙏.

Powered By
Best Wordpress Adblock Detecting Plugin | CHP Adblock